产品
文章
搜索
名称描述内容
产品中心
商品描述
Phage display: phage display technology is a new technology of fusion expression of exogenous peptide or protein gene and phage specific protein gene on its surface. This technique enables the unification of phenotypes and genotypes. With the further development of phage display technology, its superiority has been recognized by more and more laboratories, making the use of this technology expanding continuously and enabling the technology to be continuously perfected and developed. The display system is divided into: filamentous phage display system, T7 phage display system, T4 phage and lamda phage display system.
Name: Ph.D.-7 phage display peptide library kit
Product Manual
Phage display is an in vitro screening technique. It can display a series of polypeptide or protein libraries on the outside of phage particles, while the DNA encoding these proteins is located inside the virus particles. Using the link between the displayed protein and its encoded DNA, we can quickly screen out the kin of a given target molecule (antibody, enzyme, cell surface receptor, etc.) through a simple in vitro screening method called "biopanning" And ligands. The simplest panning method (see Figure 1) is to incubate a phage library displaying different peptides with target molecules immobilized on plates or beads, first wash off unbound phage and then elute the specifically bound phage. Amplify the eluted phage. The above-described binding-amplification process is repeated to enrich the phage of the polypeptide sequence bound to the target molecule. After 3-4 rounds of screenings, each clone was identified by DNA sequencing or ELISA.
Name: Ph.D.-7 phage display peptide library kit
Product Manual
Phage display is an in vitro screening technique. It can display a series of polypeptide or protein libraries on the outside of phage particles, while the DNA encoding these proteins is located inside the virus particles. Using the link between the displayed protein and its encoded DNA, we can quickly screen out the kin of a given target molecule (antibody, enzyme, cell surface receptor, etc.) through a simple in vitro screening method called "biopanning" And ligands. The simplest panning method (see Figure 1) is to incubate a phage library displaying different peptides with target molecules immobilized on plates or beads, first wash off unbound phage and then elute the specifically bound phage. Amplify the eluted phage. The above-described binding-amplification process is repeated to enrich the phage of the polypeptide sequence bound to the target molecule. After 3-4 rounds of screenings, each clone was identified by DNA sequencing or ELISA.
Ph.D.-7 kit
# E8100S. 10 panning experiments $ 5,559
The company is located in:
Ph.D.-12 kit
# E8110S 10 panning experiments. $ 5,559
The company is located in:
Ph.D.-C7C kit
# E8120S 10 panning experiments. $ 6,549
The company is located in:
Anti-M13 pIII monoclonal antibody
Anti-M13 pIII monoclonal antibody (murine IgG2a isotype) was derived from A23 hybridoma produced by fusion of murine myeloma cells and spleen cells. BALB / c mice were immunized with peptides (residues 259-406) half the C-terminal of M13 capsid protein III.
Note: ELISA is not recommended for use with this antibody to identify complete phage, as antigenic determinants on M13 phage are not readily exposed.
# E8033S 0.1 ml. ¥ 2,649
Ph.D. kit composition
- 10 independent panning experiments of sufficient phage display library, 109 clones
- 28 gIII sequencing primer (100 pmol)
- 96 gIII sequencing primer (100 pmol)
- E. coli host strain ER2738
- Controlled experimental target molecule (streptavidin) and eluent (biotin)
- Detailed user manual
The recommended sequencing primer sequences (not provided) are as follows:
-28 gIII sequencing primer (22-mer)
5'd (GTATGGGATTTTGCTAAACAAC) 3'
# E8100S. 10 panning experiments $ 5,559
The company is located in:
Ph.D.-12 kit
# E8110S 10 panning experiments. $ 5,559
The company is located in:
Ph.D.-C7C kit
# E8120S 10 panning experiments. $ 6,549
The company is located in:
Anti-M13 pIII monoclonal antibody
Anti-M13 pIII monoclonal antibody (murine IgG2a isotype) was derived from A23 hybridoma produced by fusion of murine myeloma cells and spleen cells. BALB / c mice were immunized with peptides (residues 259-406) half the C-terminal of M13 capsid protein III.
Note: ELISA is not recommended for use with this antibody to identify complete phage, as antigenic determinants on M13 phage are not readily exposed.
# E8033S 0.1 ml. ¥ 2,649
Ph.D. kit composition
- 10 independent panning experiments of sufficient phage display library, 109 clones
- 28 gIII sequencing primer (100 pmol)
- 96 gIII sequencing primer (100 pmol)
- E. coli host strain ER2738
- Controlled experimental target molecule (streptavidin) and eluent (biotin)
- Detailed user manual
The recommended sequencing primer sequences (not provided) are as follows:
-28 gIII sequencing primer (22-mer)
5'd (GTATGGGATTTTGCTAAACAAC) 3'
